Thread Rating:
  • 0 Vote(s) - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
Curious output of obittools and obiannotate
#1
Hello all,

I have a fasta file that is the output of ecotag. When that fasta is used as the input to either obihead or obiannotate (and possible others), interesting characteristics are observable in the output.

For comparison, I present scenario 1: Running obihead and obiannotate on the fasta file that was the input for ecotag.

This file is named db_v05.fasta

Code:
head -n 14 db_v05.fasta


>AB568599; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=27125; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;    Sporothrix schenckii mitochondrial DNA, complete genome, strain: ATCC 10268
gttatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggggtaagtagtttattaggtgcaattaactttataactacagtaattaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggtggtgatcctattttatt
ccaacatcttttc
>AB568600; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=26095; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;    Sporothrix schenckii mitochondrial DNA, complete genome, strain: KMU2052
attatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggagtaagtagtatattaggtgcaattaactttataactacagtagttaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggaggtgatcctattttatt
ccaacatcttttc

Code:
 obihead -n 2 --without-progress-bar db_v05.fasta


>AB568599; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=27125; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;     Sporothrix schenckii mitochondrial DNA, complete genome, strain: ATCC 10268
gttatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggggtaagtagtttattaggtgcaattaactttataactacagtaattaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggtggtgatcctattttatt
ccaacatcttttc
>AB568600; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=26095; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;     Sporothrix schenckii mitochondrial DNA, complete genome, strain: KMU2052
attatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggagtaagtagtatattaggtgcaattaactttataactacagtagttaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggaggtgatcctattttatt
ccaacatcttttc

As far as I can tell, the output is the same. obiannotate with no options produced the same output.


Scenario 2: using a fasta file that was the output of ecotag

Command used to produce fasta:


Code:
ecotag -d embl_last -R db_v05.fasta Pool1.ali.assigned.uniq.c10.400.clean.fasta > \
 wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta

head -n 7 wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; taxid=69555; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '303-A': 3, '1147-K': 13, '239-B': 2, '1045-B': 3, '1174-A': 6, '1106-D': 1, '90-B': 1, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '771-B': 8, '1229-D': 5, '240-B': 1, '247-A': 1, '274-C': 2}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '303-A': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1125-A': 21, '1106-D': 1, '90-B': 1, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '771-B': 8, '1229-D': 5, '239-B': 2, '247-A': 1, '274-C': 2}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; match_count={'db_v05': 773}; obiclean_head=True; taxid_by_db={'db_v05': 69555}; family_name=None; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '303-A': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1125-A': 's', '1106-D': 's', '90-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '771-B': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '274-C': 's'}; obiclean_headcount=1; count=1176; id_status={'db_v05': True}; best_match={'db_v05': 'AJ622961;'}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc

Code:
obihead -n 1 --without-progress-bar wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; count=1176; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; match_count={'db_v05': 773}; family_name=None; best_match={'db_v05': 'AJ622961; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


There a few things worth pointing out at this point.
1) taxid was transported into the best_match tag's field:  best_match={'db_v05': 'AJ622961; taxid=69555; '};
2) id_status={'db_v05': True};  and family_name=None;  got swapped.     I don't see any issue with that, but I'm not sure if it should happen.


Using obiannotate with no options produces the same output as obihead.
When I try to use obiannotate with "--delete-tag" options, erroneous output is produced.
Code:
obiannotate --without-progress-bar --delete-tag=rank --delete-tag=order_name --delete-tag=rank_by_db --delete-tag=order wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta > temp

head -n 7 temp


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; match_count={'db_v05': 773}; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; count=1176; family_name=None; best_match={'db_v05': 'AJ622961; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


Note that the "rank" tag is before the strange "best_match" tag and that it was successfully deleted.
However, the "order", "order_name", and "rank_by_db" tags are after "best_match" and were not deleted.


Now, here is what happens when I try to remove the "best_match" tag:


Code:
obiannotate --without-progress-bar --delete-tag=best_match wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta > temp

head -n 7 temp


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; count=1176; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; match_count={'db_v05': 773}; family_name=None; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


Note the stray " '}; " left over from the deletion of "best_match".


Suggestions on how to proceed?
Thanks in advance!
Reply


Forum Jump:


Users browsing this thread: 1 Guest(s)