Welcome, Guest
You have to register before you can post on our site.

Username/Email:
  

Password
  





Search Forums

(Advanced Search)

Forum Statistics
» Members: 421
» Latest member: velesycahvs3316
» Forum threads: 30
» Forum posts: 81

Full Statistics

Online Users
There is currently 1 user online
» 0 Member(s) | 1 Guest(s)

Latest Threads
ecotag with custom refere...
Forum: Using OBITools
Last Post: celine.mercier
09-14-2017, 02:49 PM
» Replies: 1
» Views: 245
Error running obiconvert
Forum: Using OBITools
Last Post: laur34
11-01-2016, 08:18 PM
» Replies: 3
» Views: 5,258
Problem with building the...
Forum: Using OBITools
Last Post: Robert
10-11-2016, 09:46 AM
» Replies: 3
» Views: 4,699
abiannotate: how to acces...
Forum: Using OBITools
Last Post: coissac
08-11-2016, 04:39 AM
» Replies: 1
» Views: 2,625
Database
Forum: Using OBITools
Last Post: adejode
08-08-2016, 02:50 PM
» Replies: 0
» Views: 1,578
obiextract: bug?
Forum: Using OBITools
Last Post: cbird
08-05-2016, 12:16 AM
» Replies: 2
» Views: 2,199
Parallel Strategies
Forum: Using OBITools
Last Post: cbird
08-01-2016, 03:11 PM
» Replies: 1
» Views: 1,912
ngsfilter: pattern matchi...
Forum: Using OBITools
Last Post: cbird
08-01-2016, 02:53 PM
» Replies: 4
» Views: 2,858
illuminapairedend: align...
Forum: Using OBITools
Last Post: cbird
08-01-2016, 02:41 PM
» Replies: 2
» Views: 2,356
ngsfilter: error arg / fu...
Forum: Using OBITools
Last Post: coissac
07-23-2016, 03:45 PM
» Replies: 1
» Views: 1,862

 
  ngsfilter: how to represent degenerate primers in sample description file?
Posted by: cbird - 07-21-2016, 04:18 PM - Forum: Using OBITools - Replies (2)

When using ngsfilter, I want it to be able to search for degenerate primers.

I was wondering if I can use regex in the sample description file that is referenced by ngsfilter?

If yes, what flavor of regex can I use?  POSIX?  PERL?

Otherwise, does ngsfilter understand the IUPAC ambiguity code?  

The universal COI primers developed by Leray et al for metabarcoding are highly degenerate.  Consequently, there has to be a way to search allow for multiple matches at certain positions. 

Let's say my primer is

GGYCTW

I'm thinking about putting the following into my sample description file
GG[CT]CT[AT]


I know that I could set the -e argument to specify the number of mismatches, but that's not an elegant solution with 10 in 26 positions being degenerate.

Print this item

  ngsfilte
Posted by: apurvapunvar - 07-12-2016, 07:03 AM - Forum: Using OBITools - Replies (2)

Hi all members,

We had used ION Torrent platform for Honey metabarcoding
We do not used any tags for PCR amplification purpose and sequenced pooling each barcode amplicons (viz. rbcL, matK, trnL, ITS).
In that case I am unable to separate sequences base on my particular marker.
What should we do for further analysis and is not possible to annotate unique sequences using ngsfilter without using forward tag and reverse tag(In our case Forward and reverse tags are not used).


Thank you,
Apurva Punvar
Gujarat

Print this item

Big Grin no local taxon issue for using ecogrep
Posted by: quinnleo - 06-13-2016, 04:25 PM - Forum: Using OBITools - No Replies

when i try to use this command Big Grin ,

       ecogrep  -d /embl_rel_std_r123 -p CGCAGCCAGCTGCGTGAATTAATGT -e3 >muss58F.out


Reading 1276596 taxa...

No local taxon



it will stuck at here, no local taxon. however, i can successfully run ecopcr, and compile NCBI taxonomy.

Print this item

  Request for review of a metabarcoding manuscript
Posted by: mbowser - 06-10-2016, 09:35 PM - Forum: DNA Sequencing - No Replies

Dear metabarcoders,

I am new to metagenomic analysis and have been working on a metabarcoding manuscript, a trial of these methods for monitoring terrestrial arthropod assembles on the Kenai Peninsula, Alaska.  I would very much appreciate comments and advice on this topic.  Please see my draft manuscript at the URI below.  I am especially seeking feedback on the analysis and my interpretations.  The lab methods are still missing as I am waiting to receive this text from the lab that did the actual molecular work.  As I do not have access to Linux hardware at work, I chose to run most of my analysis using Galaxy.

I have temporarily posted a draft manuscript at the URI below.  Supplementary data are available via links in the pdf.

http://akentsoc.org/tmp/2015_grassland_a...0-1259.pdf

Thank you for your help.

Sincerely,

Matt

Print this item

  problem runnig ngs filter
Posted by: adejode - 06-06-2016, 08:58 PM - Forum: Using OBITools - Replies (2)

I have a problem with the ngs filter command :

ngsfilter -u nosample.fasta -t nosample.ngsfilter paired.good.fasta


Traceback (most recent call last):
  File "/usr/local/bin/ngsfilter", line 426, in <module>
    primers=readTagfile(options.taglist)
  File "/usr/local/bin/ngsfilter", line 199, in readTagfile
    len(p['tags'][0]) if p['tags'][0]!='-' else None,
TypeError: 'NoneType' object has no attribute '__getitem__'




Here is my nosample.ngsfilter file : 

experience FTF015_100um_R1 -:- GGWACWGGWTGAACWGTWTAYCCYCC GTAAACTTCAGGGTGACCAAARAAYCA F



can you identify the problem ??

thanks

Print this item

  problem runnig obigrep
Posted by: adejode - 06-02-2016, 04:24 PM - Forum: Using OBITools - Replies (2)

I'm trying to run obigrep but I got this error message.


obigrep -p 'score_norm>3.8 and score>40' paired.fastq > paired.good.fasta
paired.fastq   0.1 % |/                                                  ] remain : 00:00:13Traceback (most recent call last):
  File "/usr/local/bin/obigrep", line 42, in <module>
    for seq in goodSeq(entries):
  File "src/obitools/options/_bioseqfilter.pyx", line 79, in sequenceFilterIterator (build/temp.linux-x86_64-2.7/pyrex/obitools/options/_bioseqfilter.c:3970)
  File "src/obitools/options/_bioseqfilter.pyx", line 52, in obitools.options._bioseqfilter.filterGenerator.sequenceFilter (build/temp.linux-x86_64-2.7/pyrex/obitools/options/_bioseqfilter.c:3153)
  File "src/obitools/options/_bioseqfilter.pyx", line 53, in genexpr (build/temp.linux-x86_64-2.7/pyrex/obitools/options/_bioseqfilter.c:2446)
  File "<string>", line 1, in <module>
NameError: name 'score_norm' is not defined

Print this item

  can't get ecoprimers to work
Posted by: hglass - 05-06-2016, 12:17 AM - Forum: Using OBITools - Replies (2)

I am trying to run ecoprimers, an after countless hours of trying to figure it out I am still at a loss. I have obitools installed and am trying to convert my sequences from fasta to ecopcrdb format with the code:
obiconvert --fasta --ecopcrdb-output=sequencesDB sequences.fast 

Then I get the error message:
TypeError: object of type 'NoneType' has no len()

How do I fix this? Any help is appreciated!

Print this item

  Curious output of obittools and obiannotate
Posted by: ekrell - 04-20-2016, 03:54 PM - Forum: Using OBITools - No Replies

Hello all,

I have a fasta file that is the output of ecotag. When that fasta is used as the input to either obihead or obiannotate (and possible others), interesting characteristics are observable in the output.

For comparison, I present scenario 1: Running obihead and obiannotate on the fasta file that was the input for ecotag.

This file is named db_v05.fasta

Code:
head -n 14 db_v05.fasta


>AB568599; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=27125; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;    Sporothrix schenckii mitochondrial DNA, complete genome, strain: ATCC 10268
gttatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggggtaagtagtttattaggtgcaattaactttataactacagtaattaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggtggtgatcctattttatt
ccaacatcttttc
>AB568600; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=26095; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;    Sporothrix schenckii mitochondrial DNA, complete genome, strain: KMU2052
attatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggagtaagtagtatattaggtgcaattaactttataactacagtagttaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggaggtgatcctattttatt
ccaacatcttttc

Code:
 obihead -n 2 --without-progress-bar db_v05.fasta


>AB568599; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=27125; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;     Sporothrix schenckii mitochondrial DNA, complete genome, strain: ATCC 10268
gttatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggggtaagtagtttattaggtgcaattaactttataactacagtaattaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggtggtgatcctattttatt
ccaacatcttttc
>AB568600; count=1; merged_taxid={29908: 1}; species_name=Sporothrix schenckii; family=5152; family_name=Ophiostomataceae; scientific_name=Sporothrix schenckii; reverse_match=TAAACCTCTGGATGACCAAAAAATCA; taxid=29908; genus_name=Sporothrix; forward_error=2; forward_tm=nan; rank=species; seq_length_ori=26095; forward_match=GGTACAGGTTGAACTATCTACCCTCC; reverse_tm=nan; genus=29907; reverse_error=0; species=29908; strand=D;     Sporothrix schenckii mitochondrial DNA, complete genome, strain: KMU2052
attatctggaatacaaagtcatagtggtcctagtgtggatttagctatatttgctcttca
tttatcaggagtaagtagtatattaggtgcaattaactttataactacagtagttaatat
gagaacaccaggtataaaattacataaattatctttatttggatgagctgttgttataac
agcagttttattattattatctttacctgttttagctggtggtattactatggttttaac
agatagaaattttaatacttctttctttgaaacagccggaggaggtgatcctattttatt
ccaacatcttttc

As far as I can tell, the output is the same. obiannotate with no options produced the same output.


Scenario 2: using a fasta file that was the output of ecotag

Command used to produce fasta:


Code:
ecotag -d embl_last -R db_v05.fasta Pool1.ali.assigned.uniq.c10.400.clean.fasta > \
 wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta

head -n 7 wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; taxid=69555; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '303-A': 3, '1147-K': 13, '239-B': 2, '1045-B': 3, '1174-A': 6, '1106-D': 1, '90-B': 1, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '771-B': 8, '1229-D': 5, '240-B': 1, '247-A': 1, '274-C': 2}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '303-A': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1125-A': 21, '1106-D': 1, '90-B': 1, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '771-B': 8, '1229-D': 5, '239-B': 2, '247-A': 1, '274-C': 2}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; match_count={'db_v05': 773}; obiclean_head=True; taxid_by_db={'db_v05': 69555}; family_name=None; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '303-A': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1125-A': 's', '1106-D': 's', '90-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '771-B': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '274-C': 's'}; obiclean_headcount=1; count=1176; id_status={'db_v05': True}; best_match={'db_v05': 'AJ622961;'}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc

Code:
obihead -n 1 --without-progress-bar wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; count=1176; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; match_count={'db_v05': 773}; family_name=None; best_match={'db_v05': 'AJ622961; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


There a few things worth pointing out at this point.
1) taxid was transported into the best_match tag's field:  best_match={'db_v05': 'AJ622961; taxid=69555; '};
2) id_status={'db_v05': True};  and family_name=None;  got swapped.     I don't see any issue with that, but I'm not sure if it should happen.


Using obiannotate with no options produces the same output as obihead.
When I try to use obiannotate with "--delete-tag" options, erroneous output is produced.
Code:
obiannotate --without-progress-bar --delete-tag=rank --delete-tag=order_name --delete-tag=rank_by_db --delete-tag=order wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta > temp

head -n 7 temp


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; match_count={'db_v05': 773}; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; count=1176; family_name=None; best_match={'db_v05': 'AJ622961; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


Note that the "rank" tag is before the strange "best_match" tag and that it was successfully deleted.
However, the "order", "order_name", and "rank_by_db" tags are after "best_match" and were not deleted.


Now, here is what happens when I try to remove the "best_match" tag:


Code:
obiannotate --without-progress-bar --delete-tag=best_match wolf.ali.assigned.uniq.c10.l80.clean.tag.fasta > temp

head -n 7 temp


>M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP species_name=None; family=None; scientific_name=Caenogastropoda; rank=no rank; best_identity={'db_v05': 0.834375}; scientific_name_by_db={'db_v05': 'Caenogastropoda'}; obiclean_samplecount=21; species=None; merged_sample={'560-A': 6, '248-A': 1, '743-A': 4, '1125-A': 21, '1147-K': 13, '239-B': 2, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1086, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '240-B': 1, '247-A': 1, '1045-B': 3}; obiclean_count={'560-A': 6, '248-A': 1, '743-A': 4, '1045-B': 3, '1147-K': 13, '240-B': 1, '1174-A': 6, '1106-D': 1, '90-B': 1, '771-B': 8, '249-A': 1161, '262-A': 1, '439-A': 1, '1052-C': 9, '143-A': 1, '274-C': 2, '303-A': 3, '1229-D': 5, '239-B': 2, '247-A': 1, '1125-A': 21}; obiclean_singletoncount=20; obiclean_cluster={'560-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '248-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '743-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1045-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1147-K': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '240-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1174-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1106-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '90-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '771-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '249-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '262-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '439-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1052-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '143-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '274-C': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '303-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1229-D': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '239-B': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '247-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP', '1125-A': 'M00595:3:000000000-ALULJ:1:1101:16424:1832_CONS_SUB_SUB_CMP'}; species_list={'db_v05': []}; obiclean_internalcount=0; count=1176; obiclean_head=True; taxid_by_db={'db_v05': 69555}; id_status={'db_v05': True}; genus_name=None; obiclean_status={'560-A': 's', '248-A': 's', '743-A': 's', '1045-B': 's', '1147-K': 's', '240-B': 's', '1174-A': 's', '1106-D': 's', '90-B': 's', '771-B': 's', '249-A': 'h', '262-A': 's', '439-A': 's', '1052-C': 's', '143-A': 's', '274-C': 's', '303-A': 's', '1229-D': 's', '239-B': 's', '247-A': 's', '1125-A': 's'}; obiclean_headcount=1; match_count={'db_v05': 773}; family_name=None; taxid=69555; '}; order_name=None; rank_by_db={'db_v05': 'no rank'}; genus=None; order=None;
tatcaggtaaccttgctcatgcggggggatctgttgacctagctattttttccttacact
tagctggtgtttcatctatcttgggtgctgtaaattttattacaactattattaacatac
gatggcgaggtatgcagttcgagcgcttacctttatttgtttgatctgttaaaattactg
ctgtgctcctacttctttcacttcctgttttagcgggggcaattactatgctactcactg
atcggaactttaatacagccttttttgatcctgcggggggtggtgaccctattctttacc
aacatcttttc


Note the stray " '}; " left over from the deletion of "best_match".


Suggestions on how to proceed?
Thanks in advance!

Print this item

  R packages
Posted by: JHarrison - 03-24-2016, 08:24 PM - Forum: Using OBITools - Replies (1)

Is there a location where we can download the R packages mentioned in this tutorial: http://metabarcoding.org/IMG/html/primerdesign.html ? They don't seem to be on CRAN and I can't find them elsewhere.

Thanks,
-J

Print this item

  obiaddtaxids error/ doc error
Posted by: schoenm - 03-16-2016, 04:35 PM - Forum: Using OBITools - Replies (3)

Hey everyone,

I wanted to use the obiaddtaxids script to annotate my fasta Reference file obtained from UNITE.
It fails to annotate my UNITE files when using the command:

Code:
obiaddtaxids -d taxDB -f UNITE_FULL UNITE_public_31.01.2016.fasta
with the Error:
Code:
 File "/usr/bin/obiaddtaxids", line 402, in <module>
   species_name = s['species_name']
TypeError: string indices must be integers, not str
any suggestions on why this is happening? it should work with the UNITE/INSD ITS Release, right?

Also, while going through the documentation, i noticed that there is an example using a -T parameter, which is not actually available. the documentation should probably fixed...

thanks and regards,
max

Print this item